View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16585_high_19 (Length: 249)
Name: NF16585_high_19
Description: NF16585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16585_high_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 14 - 230
Target Start/End: Complemental strand, 37846676 - 37846460
Alignment:
| Q |
14 |
cctgtgtggcttgtggagattttcttgtaccctatcgagtgaatatatgatttggcaatgaggtttgcacnnnnnnnctattgctacttaacaaaactgg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || |
|
|
| T |
37846676 |
cctgtgtggcttgtggagattttcttgtaccctatcgagtgaatatatgatttggcaatgaggtttgcactttttttctattgctacttaacaaaacagg |
37846577 |
T |
 |
| Q |
114 |
taaggtggaatcgtctatgccaaggtgtagccatcatgtcatgtgttaagaaaaaatatatatgattcgaaaccactactttgtagaataattggtgggg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37846576 |
taaggtggaatcgtctatgccaaggtgtagccatcatgtcatgtgttaagaaaaaatatatatgattcgaaaccactactttgtagaataattggtgggg |
37846477 |
T |
 |
| Q |
214 |
gcaggaacctgtagcta |
230 |
Q |
| |
|
|||| |||||||||||| |
|
|
| T |
37846476 |
gcagaaacctgtagcta |
37846460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University