View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16585_low_22 (Length: 300)
Name: NF16585_low_22
Description: NF16585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16585_low_22 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 7 - 286
Target Start/End: Complemental strand, 24755345 - 24755066
Alignment:
| Q |
7 |
tgagatgaactcaaaggatgatgagtttgttaaatcggatgattcttcaccttccaatatggctgcggtcaaagagacttgcagtaaatcagctgctgaa |
106 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
24755345 |
tgagaagaactcaaaggatgatgagtttgttaaatcggatgattcttcaccttccaatatggctgcggtcaaagagactggcagtaaatcagctgctgaa |
24755246 |
T |
 |
| Q |
107 |
gattctactaattcagttaagaccgcggtttctgtgtctgaggtagaaaagagcaacactcgaagtgtatttctagagaattcagtagcccctcttcaag |
206 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24755245 |
gattctactaattcagttaagaccgcggcttctgtgtctgaggtagaaaagagcaacactcgaagtgtatttctagagaattcagtagcccctcttcaag |
24755146 |
T |
 |
| Q |
207 |
aagtgattgatcttgctgggaagatgaatgaggatagtgtatatccctcaacaaatgagaatgtgaaaacatcaagtttc |
286 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
24755145 |
aagtgattgatcttgctgggaggatgaatgaggatagtgtatatccctcaacaaatgagaatgcgaaaacatcaagtttc |
24755066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University