View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16585_low_30 (Length: 204)
Name: NF16585_low_30
Description: NF16585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16585_low_30 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 14 - 185
Target Start/End: Original strand, 11809208 - 11809379
Alignment:
| Q |
14 |
cataggcaacttgagcttactacctcggaggttgaccgcattcagaaacttatagatattcatggccttgataatgatttgcatgcgcaagacttacatg |
113 |
Q |
| |
|
||||| || ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11809208 |
catagacagcttgagcttgctacctcggaggttgaccgcattcagaaacttatagatattcatggccttgataatgatttgcatgcgcaagacttacatg |
11809307 |
T |
|
| Q |
114 |
cacagttacttctgacgaaagcttgaaattgtaaggacctttttgggcgggagaatgctaggcatcagcggt |
185 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
11809308 |
cacagttatttctgacaaaagcttgaaattgtaaggacctttttgggcgggaaaatgctaggcatcagcggt |
11809379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 74 - 185
Target Start/End: Original strand, 20493150 - 20493261
Alignment:
| Q |
74 |
catggccttgataatgatttgcatgcgcaagacttacatgcacagttacttctgacgaaagcttgaaattgtaaggacctttttgggcgggagaatgcta |
173 |
Q |
| |
|
||||| |||||| |||||||||||| | ||||||||||||| ||||||||| ||||||||| | ||||||| |||| | ||| |||| || || |||| |
|
|
| T |
20493150 |
catggtcttgatgatgatttgcatgtggaagacttacatgctcagttacttttgacgaaagtgttaaattgtcaggatcaattttggcgtgaaaaggcta |
20493249 |
T |
|
| Q |
174 |
ggcatcagcggt |
185 |
Q |
| |
|
|||| ||||||| |
|
|
| T |
20493250 |
ggcaccagcggt |
20493261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University