View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16585_low_31 (Length: 204)
Name: NF16585_low_31
Description: NF16585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16585_low_31 |
 |  |
|
| [»] chr8 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 130; Significance: 1e-67; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 75 - 204
Target Start/End: Original strand, 2748466 - 2748595
Alignment:
| Q |
75 |
catctcttcttcttctatctcctcaagactacaaggaagcatatgataagtccactcatcaggaacacaaatttttgttatcccattttgtgttatagtc |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2748466 |
catctcttcttcttctatctcctcaagactacaaggaagcatatgataagtccactcatcaggaacacaaatttttgttatcccattttgtgttatagtc |
2748565 |
T |
 |
| Q |
175 |
agaaatagagaaatgaatcccaacagcatc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
2748566 |
agaaatagagaaatgaatcccaacagcatc |
2748595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 11 - 60
Target Start/End: Original strand, 2748375 - 2748424
Alignment:
| Q |
11 |
catcatcaccgccaccgccaccaagaaggcgccgagcagtgccagaaaca |
60 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2748375 |
catcaccaccgccaccgccaccaagaaggcgccgagcagtgccagaaaca |
2748424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 102 - 169
Target Start/End: Original strand, 2756550 - 2756617
Alignment:
| Q |
102 |
actacaaggaagcatatgataagtccactcatcaggaacacaaatttttgttatcccattttgtgtta |
169 |
Q |
| |
|
||||||||||||||||||| |||||| || | ||||||||||||||| | |||||||||||||||| |
|
|
| T |
2756550 |
actacaaggaagcatatgaatagtccattctaccggaacacaaatttttatcatcccattttgtgtta |
2756617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University