View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16586_low_11 (Length: 226)
Name: NF16586_low_11
Description: NF16586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16586_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 15 - 219
Target Start/End: Original strand, 42227565 - 42227768
Alignment:
| Q |
15 |
tcagttgttgtattgacttttgagcatatgatttggcaaccctttatagaagatgagtactattttcatgctatgatgttgggtccaaactaattttgtt |
114 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42227565 |
tcagttggtgtat-gacttttgagcatatgatttggcaaccctttatagaagatgagtacaattttcctgctatgatgttgggtccaaactaattttgtt |
42227663 |
T |
 |
| Q |
115 |
gtatgagttcgaatatctcttgtgctccctttaataaaaagtttgcttatcgaaaataactcatatttgtatagctccctcagtcacaacttccctttgc |
214 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42227664 |
gtatgagttcgaatatctcttgtactccctttattaaaaagtttgcttatcgaaaataactcatatttgtatagctccctcagtcacaacttccctttgt |
42227763 |
T |
 |
| Q |
215 |
ttctc |
219 |
Q |
| |
|
||||| |
|
|
| T |
42227764 |
ttctc |
42227768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University