View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16586_low_6 (Length: 248)
Name: NF16586_low_6
Description: NF16586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16586_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 19 - 234
Target Start/End: Original strand, 43774270 - 43774497
Alignment:
| Q |
19 |
gtaccacatcataaaatatttcaacaaatattgcgtagtgagatatggtcagacgactgagtaactttttatacaatttatgcctctggtattgctgagg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43774270 |
gtaccacatcataaaatatttcaacaaatactgcatagtgagatatggtcagacgactgtgtaactttttatacaatttatgcctctggtattgctgagg |
43774369 |
T |
 |
| Q |
119 |
atacatttaactgtgta--cacactttaggtcggcccctctgctcggcttgaataagctggtccaagtccaac-----------ataccgaagatttgag |
205 |
Q |
| |
|
|||| |||||||||||| || |||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
43774370 |
atac-tttaactgtgtattgacgctttaggtcggcccctctgctcggcttgaataagttggtccaagtccaacatgatttttggataccgaagatttgag |
43774468 |
T |
 |
| Q |
206 |
atcctaaactaatgtcttattagtaattt |
234 |
Q |
| |
|
|||||||| |||||||||||||||||||| |
|
|
| T |
43774469 |
atcctaaaataatgtcttattagtaattt |
43774497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University