View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16586_low_7 (Length: 243)
Name: NF16586_low_7
Description: NF16586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16586_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 19 - 229
Target Start/End: Original strand, 34694548 - 34694757
Alignment:
| Q |
19 |
aaattcatgcaatatcaatcatatttattnnnnnnnnnngggaaattcaatttcctcaaactaaataataaaaggtaaatcacgtgtttgttttcttgga |
118 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34694548 |
aaattcatgcaatatcaatcatatttattaataaaaaa-gggaaattcaatttcctcaaactaaataataaaaggtaaatcacgtgtttgttttcttgga |
34694646 |
T |
 |
| Q |
119 |
tccaacgacccacatcaaaaggtcaaagcaaggaaacatacatgaaagtttgcacatggaactcaattcaatatacaaattcggaaatgttgaggtttca |
218 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34694647 |
cccaacgacccacaccaaaaggccaaagcaaggaaacatacatgaaagtttgcacatggaactcaattcaatatacaaattcggaaatgttgaggtttca |
34694746 |
T |
 |
| Q |
219 |
cctacctatgc |
229 |
Q |
| |
|
||||||||||| |
|
|
| T |
34694747 |
cctacctatgc |
34694757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University