View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16587_low_10 (Length: 375)
Name: NF16587_low_10
Description: NF16587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16587_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 106; Significance: 6e-53; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 106; E-Value: 6e-53
Query Start/End: Original strand, 19 - 156
Target Start/End: Complemental strand, 1042354 - 1042218
Alignment:
| Q |
19 |
tcacaatgttcataattttttcctcgtcgagatgctgcaacaaatatttcagaatataacttattaatatcaacattttccacacaggtccaaatcacaa |
118 |
Q |
| |
|
||||||||||||||||| |||||||||| |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| | |
|
|
| T |
1042354 |
tcacaatgttcataattctttcctcgtcaagatgctgcatcaaatatttcagaatataacttattaatatcaa-attttccacacaggtccaaatcacca |
1042256 |
T |
 |
| Q |
119 |
aacaatgctaacgatcttactcttatgaataaaacttt |
156 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
1042255 |
aacaatgttaacaatcttactcttatgaataaaacttt |
1042218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 287 - 350
Target Start/End: Complemental strand, 1042209 - 1042146
Alignment:
| Q |
287 |
tatagatacgcttgattaaaaattcaaagataacctttctcatttatattacatgatctatttt |
350 |
Q |
| |
|
|||| |||| ||||||||| |||||||||||||||||||||||| || |||||| |||||||| |
|
|
| T |
1042209 |
tatatatacacttgattaatcattcaaagataacctttctcatttctactacatgttctatttt |
1042146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University