View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16587_low_17 (Length: 289)
Name: NF16587_low_17
Description: NF16587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16587_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 18 - 279
Target Start/End: Complemental strand, 31702535 - 31702274
Alignment:
| Q |
18 |
gtttcggtttgcttggtgggtttggatatggaggaggaggtgggcccttcaatcatcttaacctcgtttttggtcttggaatgggttgtggattgggtat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31702535 |
gtttcggtttgcttggtgggtttggatatggaggaggaggtgggcccttcaatcatcttaacctcgtttttggtcttggaatgggttgtggattgggtat |
31702436 |
T |
|
| Q |
118 |
tggatatggttttggtcaaggaattggttacagttttgattatcagacacgtaagtctgcaaaatctaggaagagtttttctgatactaacaaaaccatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31702435 |
tggatatggttttggtcaaggaattggttacagttttgattatcagacacgtaagtctgcaaaatctaggaagagtttttctgatactaacaaaaccatt |
31702336 |
T |
|
| Q |
218 |
gtttttcagttatgattgtagttttttcattgtttcccaaacattgtcttattatgcctttg |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31702335 |
gtttttcagttatgattgtagttttttcattgtttcccaaacattgtcttattatgcttttg |
31702274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University