View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16587_low_25 (Length: 226)
Name: NF16587_low_25
Description: NF16587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16587_low_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 20 - 208
Target Start/End: Complemental strand, 26405803 - 26405614
Alignment:
| Q |
20 |
gcttgatttaatctcctgcagtcaatgcacattcgccataccatgactgttctgggaggaatcaataatt-atttttctcattccgaattacagtcattc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
26405803 |
gcttgatttaatctcctgcagtcaatgcacattcaccatactgtgactgttctgggaggaatcaataattcatttttctcattccgaattacagtcattc |
26405704 |
T |
 |
| Q |
119 |
ctcctttctttggtaccaattggacaggactggcccgagagctatttgaaatgggatatatcatacctgcctcgacaattttaccacttc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26405703 |
ctcctttctttggtaccaattggacaggactggcccgagagctatttgaaatgggatatatcatacctgcctcgacaattttaccacttc |
26405614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University