View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16587_low_7 (Length: 412)
Name: NF16587_low_7
Description: NF16587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16587_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 349; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 349; E-Value: 0
Query Start/End: Original strand, 14 - 398
Target Start/End: Original strand, 12222143 - 12222527
Alignment:
| Q |
14 |
tgtgaccagaatgtcctcaatcaacacaatagccattttatacccaacacaaactctccttcaagctccaaaaggaatcaattaaaaatcaactccactt |
113 |
Q |
| |
|
|||| ||||||||| |||||||| ||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12222143 |
tgtgcccagaatgtactcaatcaccacaatagccattttatacccaacacaaactcttcttccagctccaaaaggaatcaattcaaaatcaactccactt |
12222242 |
T |
|
| Q |
114 |
ggatcaattcttgcatatttcccacttaaaaatctttcaggtttgaattataacgggttagcccatatatttgggtctctccctattgcccatatgttaa |
213 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12222243 |
ggatcaattcttgcatattttccacttaaaaatctttcaggtttgaattctaatgggttagcccatatatttgggtctctccctattgcccatatgttaa |
12222342 |
T |
|
| Q |
214 |
cattgaaccttgtatttttggggatgtagtaaccattaatttggcatgctttatttgacacccttggaacactaaggggtgtagatggatgcaaacgata |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12222343 |
cattgaaccttgtatttttggggatgtagtaaccattaatttggcatgctttatttgacacccttggaacactaaggggtgtagatggatgcaaacgata |
12222442 |
T |
|
| Q |
314 |
tgtctccttgcatattgcttgaaggtatggtaatttttctaggtcagattcaactagcattctttccctgcctaccacttgattc |
398 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12222443 |
tgtctccttgcatattgcttgaaggtatggtaatttttctaggtcagattcaactagcattctttccctgcctaccacttgattc |
12222527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University