View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16588_high_10 (Length: 383)
Name: NF16588_high_10
Description: NF16588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16588_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 26 - 378
Target Start/End: Complemental strand, 2125091 - 2124737
Alignment:
| Q |
26 |
tagtggcttggtttgctaaggttacgtgcaatcttatctcaccgaatcaatgtgtttttgtcgaaggtgttactgatattaatgatttcgctaaacaagt |
125 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2125091 |
tagtggcttggtttgctaagtttacgtgcaatcttatctcaccgaatcaatgtgtttttgtcgaaggtgttactcatattaatgatttcgctaaacaagt |
2124992 |
T |
 |
| Q |
126 |
cttagagactgactatgccttatttttaaggtcaattttgacagttgggtaggtgatgagatattcgttgtgataggttatttttggtctatgatcaaca |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2124991 |
cttagagactgactatgccttatttttaaggtcaattttgacagttgggtaggtgatgagatattcgttgtgataggttatttttggtctatgatcaaca |
2124892 |
T |
 |
| Q |
226 |
aactgtgttggttcccagtgtgggccattggcctgaggatata--atatatggggttgggatctaactttgaggaagtagctccttgtttggaagcttca |
323 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2124891 |
aactgtgttggttgccagtgtgggccattggcctgaggatatatcatatatggggttgggatctaactttgaggaagtagctccttgtttggaagcttca |
2124792 |
T |
 |
| Q |
324 |
attagttgaggatgatctaagtggtttgtactctatagggttaacctatgcttct |
378 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2124791 |
attaattgaggatgatctaagtggtttgtactctatagggttaacctatgtttct |
2124737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University