View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16588_high_31 (Length: 257)
Name: NF16588_high_31
Description: NF16588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16588_high_31 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 11 - 240
Target Start/End: Complemental strand, 29734386 - 29734157
Alignment:
| Q |
11 |
ttattcttaaaatatgtaacaaatacaacgtttatcacgtatctaaataagcacnnnnnnnggaaaaaggaaacaaacaattggtctttataactagctt |
110 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29734386 |
ttattctgaaaatatgtaacaaatacaacgtttatcacgtatctaaataagcactttttttggaaaaaggaaacaaacaattggtctttataactagctt |
29734287 |
T |
 |
| Q |
111 |
tagttggtggttatagtacacaacagggttttgatggacaaaaccaagtatcgtcgtgctctaatcaaaatactaataataataggacttggaatattgt |
210 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
29734286 |
tagttggtggttatagtacacagcagggttttgatggacaaaaccaagtatcgtcgtgctctaatcaaaatactaataataattggaattggaatattgt |
29734187 |
T |
 |
| Q |
211 |
cccaacaaggcatccaaaaccaagagaatg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
29734186 |
cccaacaaggcatccaaaaccaagagaatg |
29734157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University