View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16588_high_39 (Length: 235)

Name: NF16588_high_39
Description: NF16588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16588_high_39
NF16588_high_39
[»] chr2 (1 HSPs)
chr2 (141-221)||(5863672-5863752)


Alignment Details
Target: chr2 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 141 - 221
Target Start/End: Original strand, 5863672 - 5863752
Alignment:
141 ttaatagtagtttgtttgttggcaagacaatattataaaacaagaactaggtagagtactctattgaaaactgtggaaatt 221  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5863672 ttaatagtagtttgtttgttggcaagacaatattataaaacaagaactaggtagagtactctattgaaaactgtggaaatt 5863752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University