View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16588_low_10 (Length: 400)
Name: NF16588_low_10
Description: NF16588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16588_low_10 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 105; Significance: 2e-52; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 17 - 145
Target Start/End: Complemental strand, 29475715 - 29475587
Alignment:
| Q |
17 |
acaaacattattgatttcgaaattcttagcattttttagatgaagacctgcagcagaaatttatttacaactttcttaagaactttagcttagttaacaa |
116 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
29475715 |
acaaacattatcgatttcaaaattcttagcattttttagatgaagacctgcagcagaaatttatttacaactttcttaagacctttagcttagttaacaa |
29475616 |
T |
|
| Q |
117 |
gattaaactccaacttcttctgcacatca |
145 |
Q |
| |
|
||| ||||||||||| ||| ||||||||| |
|
|
| T |
29475615 |
gataaaactccaactccttatgcacatca |
29475587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 245 - 400
Target Start/End: Complemental strand, 29475482 - 29475333
Alignment:
| Q |
245 |
aaattctaaaccttactaaaattaccagttcttgttaccttgcaggtttcacatgcggttcctgaagtttttcatgtatggacgacatggagactagttg |
344 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||||||||| || ||||| ||||||||||||| || ||| |||||||| |||||| |
|
|
| T |
29475482 |
aaattctaaaccttactaaaattaacagttctttttaccttgcaggttcgacttgcggatcctgaagtttttaatctat------catggagagtagttg |
29475389 |
T |
|
| Q |
345 |
gccttatatcaagtatagttggtctggtttgttatgctctgagcccttctttcaat |
400 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
29475388 |
gccttatgtcaagtatagtcggtctggtttgttatgctctgagcccttctttcaat |
29475333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 332 - 400
Target Start/End: Complemental strand, 29529077 - 29529009
Alignment:
| Q |
332 |
tggagactagttggccttatatcaagtatagttggtctggtttgttatgctctgagcccttctttcaat |
400 |
Q |
| |
|
|||||| ||||||| ||||| |||||| ||||||| ||| | ||||||||||||||||||||||||||| |
|
|
| T |
29529077 |
tggagagtagttgggcttatgtcaagtgtagttggcctgttatgttatgctctgagcccttctttcaat |
29529009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 332 - 400
Target Start/End: Original strand, 29612391 - 29612459
Alignment:
| Q |
332 |
tggagactagttggccttatatcaagtatagttggtctggtttgttatgctctgagcccttctttcaat |
400 |
Q |
| |
|
|||||||||||||||||| | |||||| || |||| || | |||||||||| |||||||||||||||| |
|
|
| T |
29612391 |
tggagactagttggccttgtgtcaagtgtatttggcctattgtgttatgctcagagcccttctttcaat |
29612459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University