View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16588_low_18 (Length: 346)
Name: NF16588_low_18
Description: NF16588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16588_low_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 19 - 334
Target Start/End: Complemental strand, 27296012 - 27295697
Alignment:
| Q |
19 |
gtcagggatgtcaacatgcataacacaatgaatggtgtcagaatcaaaacatggcaggtaaaaaagattcctatatgttcatcaagcttatcagaaaatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27296012 |
gtcagggatgtcaacatgcataacacaatgaatggtgtcagaatcaaaacatggcaggtaaaaaagattcctatatgttcatcaagcttatcagaaaatt |
27295913 |
T |
|
| Q |
119 |
taacttcaaaatcatttcataccgataattgaatcttctctcaaagccaaataattatgattcaatcaaatgctgcaaagctctcattcaatccaaatac |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27295912 |
taacttcaaaatcatttcataccgataattgaatcttctctcaaagccaaataattatgattcaatcaaatgctgcaaagctctcattcaatccaaatac |
27295813 |
T |
|
| Q |
219 |
cttcatcaaattgaatgaaaaatttgatctctaacaaattaaataaaaaattatgcagggtggatcaggttcagtacaaggagtactattctcaaacata |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27295812 |
cttcatcaaattgaatgaaaaatttgatctctaacaaattaaataaaaaattatgcagggtggatcaggttcagtacaaggagtactattctcaaacata |
27295713 |
T |
|
| Q |
319 |
caagtttcacaggttc |
334 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
27295712 |
caagtttcacaggttc |
27295697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 44; Significance: 5e-16; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 272 - 327
Target Start/End: Original strand, 14739019 - 14739074
Alignment:
| Q |
272 |
tgcagggtggatcaggttcagtacaaggagtactattctcaaacatacaagtttca |
327 |
Q |
| |
|
||||||||||||| ||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
14739019 |
tgcagggtggatctggttcagtacagggagtattattctcaaacatacaagtttca |
14739074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 19 - 80
Target Start/End: Original strand, 14738661 - 14738722
Alignment:
| Q |
19 |
gtcagggatgtcaacatgcataacacaatgaatggtgtcagaatcaaaacatggcaggtaaa |
80 |
Q |
| |
|
||||| ||||||||||| || || ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14738661 |
gtcagagatgtcaacatacacgactcaatgaatggtgttagaatcaaaacatggcaggtaaa |
14738722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University