View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16588_low_24 (Length: 308)
Name: NF16588_low_24
Description: NF16588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16588_low_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 18 - 298
Target Start/End: Complemental strand, 31060485 - 31060204
Alignment:
| Q |
18 |
cttctctgtcacatgccttgctgata--agttgtgatctgtatccaaaaaggccccttatacagctgcacttgtgacgtctcctcttctctgttcatatc |
115 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31060485 |
cttctctgtcacatgccttgctgatataagttgtgatctgtatccaaaaaggccccttatacagctgcacttgtgacgtctcctcttctctgttcatatc |
31060386 |
T |
|
| Q |
116 |
tttgattatcaacatgtttattgaaaaaccatggccctcctatcaaaactttttggacatcaagatggtgaaaaaattggaataggaacgttcacagatt |
215 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| | ||| |
|
|
| T |
31060385 |
ttcgattatcaacatgtttattgaaaaaccatggccctcctatcaaaactttttggacatcaagatggtgaaaaaattggaataggaac-ttcagaaatt |
31060287 |
T |
|
| Q |
216 |
tgcttccttaattgacacaaactggagaacatatgcctgccttgttttccctcaacatatgcactctcccgggtctgtctgtg |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
31060286 |
tgcttccttaattgacacaaactggagaacttacgcctgccttgttttccctcaacatatgcactctcccgtgtctgtctgtg |
31060204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University