View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16588_low_44 (Length: 235)
Name: NF16588_low_44
Description: NF16588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16588_low_44 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 141 - 221
Target Start/End: Original strand, 5863672 - 5863752
Alignment:
| Q |
141 |
ttaatagtagtttgtttgttggcaagacaatattataaaacaagaactaggtagagtactctattgaaaactgtggaaatt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5863672 |
ttaatagtagtttgtttgttggcaagacaatattataaaacaagaactaggtagagtactctattgaaaactgtggaaatt |
5863752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University