View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16590_low_12 (Length: 336)
Name: NF16590_low_12
Description: NF16590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16590_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 19 - 316
Target Start/End: Complemental strand, 2636907 - 2636610
Alignment:
| Q |
19 |
atgtagggtatttatagagtaatgaatgtgaatggggtttgggtgaaacatttattgggtacacccattactaaagagttgtccttattttgacaaacaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2636907 |
atgtagggtatttatagagtaatgaatgtgaatggggtttgggtgaaacatttattgggtacacccattactaaagagttgtccttattttgacaaacaa |
2636808 |
T |
|
| Q |
119 |
ttatctgacacgtggtgtcggttcattatcatcagtgatgtgagccacatgagatctgatcgtacggtctacattatgcatttaatttattttgataatg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2636807 |
ctatctgacacgtggtgtcggttcattatcatcagtgatgtgagccacatgagatctgatcgtacggtctacattatgcatttaatttatttttataatg |
2636708 |
T |
|
| Q |
219 |
ctatgcaacttggaacataactacctataaaaataactacctctagataaaataaaataaaacttggaacataactagtaactaccctacactttttt |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2636707 |
ctatgcaacttggaacataactacctataaaaataactacctctagataaaataaaataaaacttggaacataactagtaactaccctacactgtttt |
2636610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University