View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16590_low_22 (Length: 215)
Name: NF16590_low_22
Description: NF16590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16590_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 15 - 200
Target Start/End: Original strand, 6454970 - 6455147
Alignment:
| Q |
15 |
aaaatataaggaaaaaacaagattaatgtannnnnnngcttatcttttattacaaggaagtataatataagtatatgattatggatcatgttaattaatt |
114 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
6454970 |
aaaatataacgaaaaaacaagattaatgtatttttttgcttatcttttattacaaggaagtataatataagtat--------ggatcatgttagttaatt |
6455061 |
T |
 |
| Q |
115 |
gtgtaattaaacttgcaggagcaacaccaaaatctgtgttagagttaatgaatgtgaaggatctaaccctagcacacgtcaagagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6455062 |
gtgtaattaaacttgcaggagcaacaccaaaatctgtgttagagttaatgaatgtgaaggatctaaccctagcacacgtcaagagt |
6455147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University