View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16592_high_115 (Length: 202)
Name: NF16592_high_115
Description: NF16592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16592_high_115 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 62; Significance: 5e-27; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 62; E-Value: 5e-27
Query Start/End: Original strand, 107 - 184
Target Start/End: Original strand, 35340852 - 35340928
Alignment:
| Q |
107 |
agaggtggcaattggcattacaagagtgagttttttggtacaaaatgaaggctgggggcgtgttaaaagagaagtatt |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |||||||||||||| |
|
|
| T |
35340852 |
agaggtggcaattggcattacaagagtgagttttttggtacaaaatgaaggct-ggggtgtgtcaaaagagaagtatt |
35340928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University