View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16592_high_51 (Length: 356)
Name: NF16592_high_51
Description: NF16592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16592_high_51 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 323; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 9 - 354
Target Start/End: Original strand, 693747 - 694093
Alignment:
| Q |
9 |
gagatgaagaggtaagagttggcctttgtagaagagttcatcagcaggacagagtgtgttggaggatttgcgaggtgaaatggagattgtgaactcaaaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
693747 |
gagatgaagaggtaagagttggcctttgtagaagagttcatctgcaggacagagtgtgttggaggatttgcgaggtgaaatggagattgtgaactcaaaa |
693846 |
T |
|
| Q |
109 |
tctgaggaagaagatgatgagaatgagtcatgtgatggtgatgaagggagtgtgtatgattttgctctgtttttggctcttttcttacccatctcagctc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
693847 |
tctgaggaagaagatgatgagaatgagtcatgtgatggtgatgaagggagtgtgtatgattttgctctgtttttggttcttttcttccccatctcagctc |
693946 |
T |
|
| Q |
209 |
ttttcttctctactacatcatacatggttgcacaataatgtgctatactctcatggc-tttaggaccaaatgaataggagatgtatttaaaagattcttc |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
693947 |
ttttcttctctactacatcatacatggttgcacaataatgtgctatactctcatggcttttaggaccaaatgaataggagatgtatttaaaagattcttc |
694046 |
T |
|
| Q |
308 |
taattggttactgtgtcatcagtactctttcaccctataagtatttt |
354 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
694047 |
taattggttactgtgtcatcagtactctttgaccctataagtatttt |
694093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University