View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16592_high_56 (Length: 337)
Name: NF16592_high_56
Description: NF16592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16592_high_56 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 300; Significance: 1e-169; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 18 - 333
Target Start/End: Original strand, 28814785 - 28815100
Alignment:
| Q |
18 |
cttaacaaaagctaaccctcaaacaagtttaatcaacaaaggttgtagccaatacaacgcaacaaacttatccaatttctaccaaaatctaaacgcaact |
117 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28814785 |
cttaacaaaagctgaccctcaaacaagtttaatcaacaaaggttgtagccaatacaacgcaacaaacttatccaatttctaccaaaatctaaacgcaact |
28814884 |
T |
 |
| Q |
118 |
ttgttagacataaaatcacaagtacgaaatgatagcaagcattttgctacggcacaatcagctagaggagcaaatcctgtttatgctttgtttcagtgta |
217 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28814885 |
ttgttagacttgaaatcacaagtacgaaatgatagcaagcattttgctacggcacaatcagctagaggagcaaatcctgtttatgctttgtttcagtgta |
28814984 |
T |
 |
| Q |
218 |
ggaattatctctctaattctgattgtgctgcttgcctcgccgtcgccgatgcacaaattcggaattgctccgctggttccaacggtgcccgtgttatcta |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28814985 |
ggaattatctctctaattctgattgtgctgcttgcctcgccgtcgccgacgcacaaattcggaattgctccgctggttccaacggtgcccgtgttatcta |
28815084 |
T |
 |
| Q |
318 |
tgatggttgcttcctt |
333 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
28815085 |
tgatggttgcttcctt |
28815100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University