View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16592_high_62 (Length: 316)
Name: NF16592_high_62
Description: NF16592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16592_high_62 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 18 - 296
Target Start/End: Original strand, 3713186 - 3713464
Alignment:
| Q |
18 |
cacagaggatgaggagcagaagaagaggaagtgaagccatgttgagataaaatgcagaacaagaataaagactcaatgtttgtatgaatgtctaggttca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3713186 |
cacagaggatgaggagcagaagaagaggaagagaagccatgttgagataaaatgcagaacaataataaagactcaatgtttgtatgaatgtctaggttca |
3713285 |
T |
 |
| Q |
118 |
gttatatgtaatgttagaatagaaggtgcattaaatgtaggttttgtatgggatagaaggggatctttaagagaacatgcaggtgtttggaaagatgaac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3713286 |
gttatatgtaatgttagaatagaaggtgcattaaatgtaggttttgtatgggatagaaggggatctttaagagaacatgcaggtgtttggaaagatgaac |
3713385 |
T |
 |
| Q |
218 |
cttgaaacgaagctgaagatatcaagggtccacatttgtctccccaacccgtattttcagatcatttttaaacactagg |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3713386 |
cttgaaacgaagctgaagatatcaagggtccacatttgtctccccaacccgtattttcagatcatttttaaacactagg |
3713464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University