View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16592_high_87 (Length: 256)
Name: NF16592_high_87
Description: NF16592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16592_high_87 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 148 - 238
Target Start/End: Complemental strand, 9142752 - 9142662
Alignment:
| Q |
148 |
gattaatgcatatactgatgatgctattggaaaactatatggtgctgagcactcgggtcgagtacgcggtttgggtttgggggtttgtcca |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9142752 |
gattaatgcatatactgatgatgctattggaaaactatatggtgctgagcactcgggtcgagtacgcggtttgggtttgggggtttgtcca |
9142662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 3 - 77
Target Start/End: Original strand, 11225759 - 11225837
Alignment:
| Q |
3 |
atcatactttatgtcatggtttagtgacttgata------tctttctcattatacatatataaacaataatatttattcct |
77 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11225759 |
atcatactttatgtcatggtttagtgacttgatatctttctctttctcattatac--atataaacaataatatttattcct |
11225837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University