View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16592_high_94 (Length: 244)
Name: NF16592_high_94
Description: NF16592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16592_high_94 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 16 - 227
Target Start/End: Original strand, 17156912 - 17157125
Alignment:
| Q |
16 |
aatactaaactaatcgagcattatacaatttaaatattgctttgattgtttttggacaaggttcataagttcctaacattcttcgtaatgtcatttcttt |
115 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
17156912 |
aatagtaaactaatcgagcattatacaatttaaatattgctttgattgtttttggacaaggttcataagttcctaacattcttcgaaatgtcatttcttt |
17157011 |
T |
|
| Q |
116 |
ttacaagaaaatttgaattaagtatgttgcttgaagaatttttgtattt-aatgcttgatcattgtctgcaatacttgtctt-gattacagttgacgaat |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
17157012 |
ttacaagaaaatttgaattaagtatgttgcttgaagaatttttgtatttcaatgcttgatcattgtctgcaatacttatcttagattacagttgacgaat |
17157111 |
T |
|
| Q |
214 |
cattgcatttaact |
227 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
17157112 |
cattgcatttaact |
17157125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University