View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16592_high_96 (Length: 241)
Name: NF16592_high_96
Description: NF16592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16592_high_96 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 8 - 241
Target Start/End: Complemental strand, 45281396 - 45281164
Alignment:
| Q |
8 |
gacatcatcaaggtcctctctctcatcggatcccagtccaatgttgtcccatcctaatccactcataggtgtctaaggaggtagttgtctcggctagagt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
45281396 |
gacatcatcaaggtcctctctctcatcggatccaagtccaatgttgtcccatcctaatccactcataggtgtctaaggaggtaattatctcggctagagt |
45281297 |
T |
 |
| Q |
108 |
tttggatagtaaaaccctaatctcactctacgaaaggctaactcatggcatccatacacacttttctaacttaaaaacgtcatattttgcacattcttac |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45281296 |
tttggatagtaaaaccctaatctcactctacg-aaggctaactcatggcatccatacacacttttctaacttaaaaacgtcatattttgcacattcttac |
45281198 |
T |
 |
| Q |
208 |
ttaacaggtccatcatcatgtaatcagaggagtt |
241 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
45281197 |
ttaacaggtacatcatcatgtaatcagaggagtt |
45281164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University