View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16592_high_98 (Length: 240)
Name: NF16592_high_98
Description: NF16592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16592_high_98 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 1 - 148
Target Start/End: Original strand, 45676890 - 45677038
Alignment:
| Q |
1 |
atgttgtaaaccttctacatcgaagacatactattaatatgtgtgatctttgaaccttaagtccatagatattgtgtttacgatggacttaacgatatat |
100 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45676890 |
atgttgtagaccttctacatcgaagacatactattaatatgtgtgatctttaaaccctaagtccatagatattgtgtttacgatggacttaacggtatat |
45676989 |
T |
|
| Q |
101 |
tttgttgctcgctttccttcc-actcatgtaatttagagaatttggtta |
148 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
45676990 |
cttgttgctcgctttccttccggctcatgtaatttagagaatttggtta |
45677038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University