View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16592_low_116 (Length: 214)
Name: NF16592_low_116
Description: NF16592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16592_low_116 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 23 - 198
Target Start/End: Original strand, 20118238 - 20118414
Alignment:
| Q |
23 |
tggcaaaagtgtcatgcagaagctcattttacttcttacaaattgaaccaactcacatctaactcaaacaatcatagcaaagtgaaagaaatcaaacatc |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
20118238 |
tggcaaaagtgtcatgcagaagctcattttacttcttacaaattgaaccaactcacatctaactcaaacaatcatagcaatgtgaaagaaatcaaacatc |
20118337 |
T |
|
| Q |
123 |
gccattctaaatgnnnnnnnnnnnnnnntatacaaattatagtgcaga-tttctaagcctgaaaaagaagtaatgaa |
198 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
20118338 |
gccattctaaatgaaaaataaaacaaaatatacaaattatagtgcagattttctaagcctgaaaaagaagtaatgaa |
20118414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 52 - 103
Target Start/End: Original strand, 26043917 - 26043968
Alignment:
| Q |
52 |
tacttcttacaaattgaaccaactcacatctaactcaaacaatcatagcaaa |
103 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26043917 |
tacttcttacaaattgatgcaactcacatctaactcaaacaatcatagcaaa |
26043968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University