View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16592_low_68 (Length: 303)
Name: NF16592_low_68
Description: NF16592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16592_low_68 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 11 - 287
Target Start/End: Complemental strand, 10801249 - 10800984
Alignment:
| Q |
11 |
caaaggatcgagaacttgctgcccaattttcaatgggaacaaaatagaggtagtannnnnnnnatgagaacatatataacatgctatgatannnnnnn-g |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| | |
|
|
| T |
10801249 |
caaaggatcgagaacttgctgcccaattttcaatgggaacaaaatagaggtagtattttttttatgagaacatatataacatgctataatattttttttg |
10801150 |
T |
 |
| Q |
110 |
tgtttgacattgattttattttattataacatgatcgtgatatattggctatatatagcattgctcttgatagaaaaatgttgtaatgcccccttcccca |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10801149 |
tgtttgacattgattttattttattataacatgatcgtgatatattgg------------ttgctcttgatagaaaaatgttgtaatgcccccttcccca |
10801062 |
T |
 |
| Q |
210 |
ttatgttgaagcaaggaaaaatgtatattttgaacgacatattaatatatctgttcataggaataacttgttactaac |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10801061 |
ttatgttgaagcaaggaaaaatgtatattttgaacgacatattaatatatctgttcataggaataacttgttactaac |
10800984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University