View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16592_low_7 (Length: 631)
Name: NF16592_low_7
Description: NF16592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16592_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 356; Significance: 0; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 356; E-Value: 0
Query Start/End: Original strand, 218 - 616
Target Start/End: Original strand, 9073068 - 9073467
Alignment:
| Q |
218 |
cttggtggttagggttgcagcaagtcttgcacttagagattctgtgaaacatgaagctactcgttgcatggagtcacctagtggtgttactactctattg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9073068 |
cttggtggttagggttgcagcaagtcttgcacttagagattctgtgaaacatgaagctactcgttgcatggagtcacctagtggtgttactactctattg |
9073167 |
T |
 |
| Q |
318 |
agctggtgtaggtaccttcttgctagcatgtattcaccttttgccactgcttcagcacatgctagaagcaagtgcactagttgaagtccactatcttgct |
417 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
9073168 |
agctggtgtaggtaccttcttgctagcatgtattcaccttttgccactgcttcagcacatgctagaagcaagtgcactaattgaagtccactgtcttgct |
9073267 |
T |
 |
| Q |
418 |
cctacatatattagatatatatcttttaagttcataaatcttcaaaagaaatctagtaaattgcttaaaa-tatatttttctagatcatgattattcaga |
516 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
9073268 |
cctacatatattagatatatatcttttaagttcataaatcttcaaaagaaatctagtaaattgcttaaaattatatttttctagatcatgattattcaga |
9073367 |
T |
 |
| Q |
517 |
tgtacatcaagtattagataattattacaaaaatcgaaggcagacgggcaataagctgcgctagtaatcctttttggatgacataaccgatatcataaat |
616 |
Q |
| |
|
||||||||||| |||| | |||||||||||||||||||||||| |||||||||||||||||| |||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
9073368 |
tgtacatcaagcattaaacaattattacaaaaatcgaaggcaggcgggcaataagctgcgctggtaatcctttctggatgacataaccaatatcataaat |
9073467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 135; E-Value: 5e-70
Query Start/End: Original strand, 21 - 159
Target Start/End: Original strand, 9072871 - 9073009
Alignment:
| Q |
21 |
acacgctcttccgcctcaaacgcctcgaaaatggcttggttagcggtaaagtgtgcgaatttgatgtaagggcaagcttggtagacaatttggtatatct |
120 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9072871 |
acacgctcttcagcctcaaacgcctcgaaaatggcttggttagcggtaaagtgtgcgaatttgatgtaagggcaagcttggtagacaatttggtatatct |
9072970 |
T |
 |
| Q |
121 |
tgaggacttccatagggtttgatgggaaggtagataaac |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9072971 |
tgaggacttccatagggtttgatgggaaggtagataaac |
9073009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University