View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16592_low_80 (Length: 281)
Name: NF16592_low_80
Description: NF16592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16592_low_80 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 153; Significance: 4e-81; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 97 - 265
Target Start/End: Complemental strand, 2561077 - 2560909
Alignment:
| Q |
97 |
gaataagagtgaaacgtatggttagaaataacatatgcaagtctcggttcaaaactagaggaggacaaataacatcaggcttatataatcaatatctata |
196 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2561077 |
gaataagagtgaaacgtgtggttagaaataacatatgcaagtctcggttcaaaactagaggaggacaaataacatcaggcttatataatcaatatctata |
2560978 |
T |
 |
| Q |
197 |
accatgattgattaacttgaaattgagacacattttgtattgactaaggaattgacggactatggaatt |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
2560977 |
accatgattgattaacttgaaattgagacacgttttgtatttactagggaattgacggactatggaatt |
2560909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 16 - 84
Target Start/End: Complemental strand, 2561198 - 2561130
Alignment:
| Q |
16 |
gaagcaagatcatattgaaacaatagcatatggagggtgtttgacgcttcaaagtaacacaagatccta |
84 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2561198 |
gaagcaagatcatattgaaacaatagcatatggagggtgtttgacgcttcaaagtaacacaagatccta |
2561130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 185 - 265
Target Start/End: Complemental strand, 2559536 - 2559456
Alignment:
| Q |
185 |
tcaatatctataaccatgattgattaacttgaaattgagacacattttgtattgactaaggaattgacggactatggaatt |
265 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| ||||||||| || | |||||||||||||||||||||| |
|
|
| T |
2559536 |
tcaatatccataaccatgattgattaacttgaaattgagacacgttttgtatttaccagggaattgacggactatggaatt |
2559456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University