View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16592_low_81 (Length: 281)
Name: NF16592_low_81
Description: NF16592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16592_low_81 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 139; Significance: 9e-73; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 9e-73
Query Start/End: Original strand, 116 - 265
Target Start/End: Complemental strand, 8892815 - 8892665
Alignment:
| Q |
116 |
aagacaagatggttataaagtacttaaagccacacattgtgcaatgtgacgagtatgggaaaccaccatttaggtt-agtacaagtgtttgatgcgcata |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8892815 |
aagacaagatggttataaagtacttaaagccacacattgtgcaatgtgacgagtatgggaaaacaccatttaggtttagtacaagtgtttgatgcgcata |
8892716 |
T |
 |
| Q |
215 |
atatgcaagttttgtaaatttgggagtacaatttgattctttctaagaagt |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8892715 |
atatgcaagttttgtaaatttgggagtacaatttgattctttctaagaagt |
8892665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 8892915 - 8892854
Alignment:
| Q |
1 |
tttcatttgactaagatatggaagaatataaagtacaaacaagtgtaagaaaaaatcttgaa |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8892915 |
tttcatttgactaagatatggaagaatataaagtacaaacaagtgtaagaaaaaatcttgaa |
8892854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University