View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16592_low_85 (Length: 275)
Name: NF16592_low_85
Description: NF16592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16592_low_85 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 1057666 - 1057419
Alignment:
| Q |
1 |
agtaaagattttgtcaagtttttcatttttaaccatagttcttgcccatataaaccaacatgctttagtcacnnnnnnnnnnnnnnntccaacatgctgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
1057666 |
agtaaagattttgtcaagtttttcatttttaaccatagttcttgcccatataaaccaacatgctttagtcacaaaaaataaaaaaaattcaacatgctgt |
1057567 |
T |
|
| Q |
101 |
gaaca-ttaatgacatataaccggccggtaaaagctcatgtttaggggttcatttctagactcatatgtaaaaatttatcagtttgaagatgtcaactcc |
199 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
1057566 |
gaacaattaatgacatataaccggccggtaaaagctcatggttagggcttcatttctagactcataggtaaaaatttattggtttgaagatgtcaactcc |
1057467 |
T |
|
| Q |
200 |
ttaaataaatactaatat-aaacgttaatgttaagtttcaaacttcaa |
246 |
Q |
| |
|
||||||||||| ||||| |||||| |||||||||||| || |||||| |
|
|
| T |
1057466 |
ttaaataaatatcaatataaaacgtcaatgttaagttttaagcttcaa |
1057419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University