View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16592_low_87 (Length: 271)
Name: NF16592_low_87
Description: NF16592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16592_low_87 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 262
Target Start/End: Original strand, 45280934 - 45281188
Alignment:
| Q |
1 |
acgtaatgcgagatctgatctgtggttcactatgttatgacgcatgacactcaaacaacaagaccacactagctatagctagctagctttgtgttgtaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45280934 |
acgtaatgcgagatctgatctgtgattcactatgttatgacacatgacactcaaacaacaagaccacactagctatagctagctagctttgtgttgtaaa |
45281033 |
T |
|
| Q |
101 |
ttaaattaaatcgaactaactatggccaaccaataaaatcaaatttataaaatttataccggcccaacacatgttaatacgacctaatatccctggcctg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45281034 |
ttaaattaaatcgaactaactatggccaaccaataaaatcaaattta-------tataccggcccaacacatgttaatacgacctaatatccctggcctg |
45281126 |
T |
|
| Q |
201 |
agtggttgttatgggatgaaggtggtgagcgttgaacaactcctctgattacatgatgatgt |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45281127 |
agtggttgttatgggatgaaggtggtgagcgttgaacaactcctctgattacatgatgatgt |
45281188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University