View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16592_low_88 (Length: 266)
Name: NF16592_low_88
Description: NF16592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16592_low_88 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 256
Target Start/End: Complemental strand, 42769176 - 42768921
Alignment:
| Q |
1 |
cacttctttctcaaccctttgataatatcaacctcctctcttcctctgcagctatgtatggtggcaaaatggcaaccattcataacggtgcgcctattca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42769176 |
cacttctttctcaaccctttgataatatcaacctcctctcttcctctgcagctatgtatggtggcaaaatggcaaccattcataacggtgcgcctattca |
42769077 |
T |
 |
| Q |
101 |
aatctacgctaaactcaaactcgaatcgaataaaaccaaaatccaccttgtttggaatagaggtctttatgttcaaggctactcaccaaccattcatcca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42769076 |
aatctacgctaaactcaaactcgaatcgaataaaaccaaaatccaccttgtttggaatagaggtctttatgttcaaggctactcaccaaccattcatcca |
42768977 |
T |
 |
| Q |
201 |
acaacatcaattgatctatcttctattgccacttttgatgttttgtcaggttcatc |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42768976 |
acaacatcaattgatctatcttctattgccacttttgatgttttgtcaggttcatc |
42768921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 102; Significance: 1e-50; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 31 - 256
Target Start/End: Original strand, 2452382 - 2452607
Alignment:
| Q |
31 |
acctcctctcttcctctgcagctatgtatggtggcaaaatggcaaccattcataacggtgcgcctattcaaatctacgctaaactcaaactcgaatcgaa |
130 |
Q |
| |
|
||||| |||||||| | ||||| || ||||||||||||| ||| ||||||||||| ||||| || || |||||||| || ||| ||||||| ||||| || |
|
|
| T |
2452382 |
acctcatctcttccacggcagccatatatggtggcaaaagggccaccattcataatggtgcccccatccaaatctatgccaaattcaaactagaatcaaa |
2452481 |
T |
 |
| Q |
131 |
taaaaccaaaatccaccttgtttggaatagaggtctttatgttcaaggctactcaccaaccattcatccaacaacatcaattgatctatcttctattgcc |
230 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||||||||||||||||| || || ||||||||||| || || | |||||| ||||| |||||| |
|
|
| T |
2452482 |
caaaaccaaaatccaccttgtttggaatcgaggactttatgttcaaggctactcgcctactattcatccaaccacctccactgatctctcttccattgcc |
2452581 |
T |
 |
| Q |
231 |
acttttgatgttttgtcaggttcatc |
256 |
Q |
| |
|
|| || || ||||||||||||||||| |
|
|
| T |
2452582 |
accttggacgttttgtcaggttcatc |
2452607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University