View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16593_high_6 (Length: 277)
Name: NF16593_high_6
Description: NF16593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16593_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 74 - 257
Target Start/End: Original strand, 7914019 - 7914202
Alignment:
| Q |
74 |
tgcaggaagaagcagaaagtggggtcagtcaagtttcagagattgggacaatatgtcatcttaaagaaacgagattgaattatagtgaaggtgtctgagc |
173 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7914019 |
tgcaagaagaagcagaaagtggggtcagtcaagtttcagagattgggacaatatgtcatcttaaagaaacgagattgaattatagtgaaggtgtctgagc |
7914118 |
T |
|
| Q |
174 |
ccagcacagttgtggtagttttaaagggcttgatatgcatactaaattcaaagcttcttcgttatttttatttatttatcgtca |
257 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7914119 |
ccagcacagttgtgttagttttaaagggcttgatatgcatgctaaattcaaagcttcttcattatttttatttatttatcgtca |
7914202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University