View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16594_high_8 (Length: 269)
Name: NF16594_high_8
Description: NF16594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16594_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 86 - 253
Target Start/End: Original strand, 4045187 - 4045354
Alignment:
| Q |
86 |
ttggattgcatttgatttcggtacatgttttgagttttgcaaagtataatatttaacaccaacaataaagaggtctaagaggtaaaaattaaagtttgaa |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4045187 |
ttggattgcatttgatttcggtacatgttttgagttttgcaaagtataatatttaacaccaacaataaagaggtctaagaggtaaaaattaaagtttgaa |
4045286 |
T |
 |
| Q |
186 |
tcccttaactaaatgtttagaagtttaattgataaacaacagtagaaatcttatccatggtaacaaac |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4045287 |
tcccttaactaaatgtttagaagtttaattgataaacaacagtagaaatcttatacatggtaacaaac |
4045354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University