View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16594_low_14 (Length: 234)
Name: NF16594_low_14
Description: NF16594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16594_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 18 - 209
Target Start/End: Original strand, 51961420 - 51961612
Alignment:
| Q |
18 |
atttttggtcaatccaaaacattagcccctactctaaatactt-aataaatgtcaaattggattgatcttgcttgatcttgattttaaatttatgagctg |
116 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
51961420 |
atttttggtcaatccagaacattagcccctactctaaatactttaataaatgtcaaattggattgatcttgcttaatcttgattttaaatttatgagctg |
51961519 |
T |
|
| Q |
117 |
caactttctccagcttacaaccagaacgaattttcatccttctaataattctagatatacgcttgcaagttgcaatggtctaatcttccatcc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51961520 |
caactttctccagcttacaaccagaacgaattttcatccttctaataattctagatatacgcttgcaagttgcaatggtctaatcttccatcc |
51961612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University