View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16595_high_13 (Length: 244)
Name: NF16595_high_13
Description: NF16595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16595_high_13 |
 |  |
|
| [»] scaffold0110 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0110 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: scaffold0110
Description:
Target: scaffold0110; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 19 - 233
Target Start/End: Original strand, 35561 - 35775
Alignment:
| Q |
19 |
tgcacattactcaaagattgttgttcaagagtagcattattatttctcaaaattatatgcttagagcatacctgaattagcttatgagccataacaggag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35561 |
tgcacattactcaaagattgttgttcaagagtagcattattatttctcaaaattatatgcttagagcatacctgaattagcttatgagccataacaggag |
35660 |
T |
 |
| Q |
119 |
taatattcactgctctctacacacacaaatacgaaaggtgcttcagttgttttgcttcataagcataaccatcatcatgtgaaatagaaaatacaataaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35661 |
taatattcactgctctctacacacacaaatacgaaaggtgcttcagttgttttgcttcataagcataaccatcatcatgtgaaatagaaaatacaataaa |
35760 |
T |
 |
| Q |
219 |
cttttgtcacttcat |
233 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
35761 |
cttttgtcacttcat |
35775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University