View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16595_high_9 (Length: 297)
Name: NF16595_high_9
Description: NF16595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16595_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 1 - 285
Target Start/End: Complemental strand, 401743 - 401459
Alignment:
| Q |
1 |
tgacaactgatgtttattatctgcttctgcaacacaatgcttgtctctgtaattaaacatttaacaaatttgggcttttaattcccttcctctgactttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
401743 |
tgacaactgatgtttattatctgcttctgcaacacaatgcttatctgtgtaattaaacatttaacaaatttgggcttttaattcccttcctctgactttg |
401644 |
T |
 |
| Q |
101 |
tgatgctttttggcaggtttggcaggcacttttggctgttagaacacttgtgctgccaccagctgaagacattgaaacatggctcaattttgcttctctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
401643 |
tgatgctttttggcaggtttggcaggcacttttggctgttagaacacttgtgctgccaccagctgaagacattgaaacatggctcaattttgcttctctt |
401544 |
T |
 |
| Q |
201 |
tgcagaaaaagtgggcgcattagccaagcaagatctactttagttaaacttctacaggtttgaactgtgcacctggtctatgatg |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
401543 |
tgcagaaaaagtgggcgcattagccaagcaagatctactttagttaaacttctacaggtttgaactgtgcacctggtctatgatg |
401459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University