View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16596_high_12 (Length: 392)
Name: NF16596_high_12
Description: NF16596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16596_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 19 - 376
Target Start/End: Complemental strand, 9574977 - 9574618
Alignment:
| Q |
19 |
cttgccgcttcttctgactctctttatgaattgattatgtctaagcttaactttgaatttttcgtgaagtcatca--cccgtccagttatttttctttct |
116 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| | ||||| | | ||||||||||||||||||||||| |
|
|
| T |
9574977 |
cttgccgcttcttctgactatctttatgaattgattatgtctaagcttaactttgaattttccatgaaggattgaggcccgtccagttatttttctttct |
9574878 |
T |
 |
| Q |
117 |
caaaataaatatgcagaggaagttattgagcacacatgtatgtctgctggcaagtcatcacccacacatgtgaatacaaaggcaaaactcagtggttctt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
9574877 |
caaaataaatatgcagaggaagttattgagcacacatgtatgtctactggcaagtcatcacccatacatgtgaatacaaaggcaaaactcagtggttctt |
9574778 |
T |
 |
| Q |
217 |
caagaaactcctatgaagatccaacataatatcataacctcgcttgatctttgcaatacctgacatttacaagatcaaatatctcttctgaagttcaaga |
316 |
Q |
| |
|
|| ||||| ||||||||||||||||||||||||||| |||||||||| | ||| | ||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
9574777 |
catgaaacccctatgaagatccaacataatatcatagcctcgcttgagcattgtagtacctgacatttacaagatcaaatatctcttatgaagttcaaga |
9574678 |
T |
 |
| Q |
317 |
agtgtgcttgtttatacataacccaaaaacacaacacatgtctttttgaaaagtattatt |
376 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9574677 |
agtgtgcttgtttatacataccccaaaaacacaacacatgtctttatgaaaagtattatt |
9574618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 279 - 359
Target Start/End: Original strand, 25745339 - 25745419
Alignment:
| Q |
279 |
acatttacaagatcaaatatctcttctgaagttcaagaagtgtgcttgtttatacataacccaaaaacacaacacatgtct |
359 |
Q |
| |
|
|||||||||||| || ||||||||| || ||||||| | || ||||||||||| ||| | ||||||||| |||| |||||| |
|
|
| T |
25745339 |
acatttacaagaccagatatctcttatgtagttcaacatgtatgcttgtttatgcatgatccaaaaacataacatatgtct |
25745419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University