View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16596_high_13 (Length: 388)
Name: NF16596_high_13
Description: NF16596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16596_high_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 335; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 335; E-Value: 0
Query Start/End: Original strand, 20 - 379
Target Start/End: Original strand, 35915878 - 35916237
Alignment:
| Q |
20 |
agaaggaggagacaagaaataaggaggagtattgttcaagattgtgtttgtgatgatataactgatgatgatttgcatgaacttaaaggatgcattgaac |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35915878 |
agaaggaggagacaagaaataaggaggagtattgttcaagattgtgtttgtgatgatataactgatgatgatttgcatgaacttaaaggatgcattgaac |
35915977 |
T |
 |
| Q |
120 |
ttgggtttggattcaatgaagaagatggtcagagattgtgtaatacattgcctgcccttgatctttattttgctgttaatagaggtttgtcaccaagccc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35915978 |
ttgggtttggattcaatgaagaagatggtcagagattgtgtaatacattgcctgcccttgatctttattttgctgttaatagaggtttgtcaccaagccc |
35916077 |
T |
 |
| Q |
220 |
tgtttctacacctcaaagtcgtgcttcatcccttggggctcgttcttcttcctttggaagccctagaagtgatgctgactcatggaagatttgtagccca |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35916078 |
tgtttctacacctcaaagtcgtgcttcatcccttggggctcgttcttcttcctttggaagccctagaagtgatgctgactcatggaagatttgtagccca |
35916177 |
T |
 |
| Q |
320 |
ggttaactttctttgcatttttcttaacaatcannnnnnngccttaatcctttgcttctc |
379 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
35916178 |
ggttaactttctttgcatttttcttaacaatcatttttttgccttaatcctttggttctc |
35916237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University