View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16597_high_10 (Length: 334)
Name: NF16597_high_10
Description: NF16597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16597_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 18 - 323
Target Start/End: Original strand, 39852484 - 39852784
Alignment:
| Q |
18 |
tctaatatgaggttaatcttcatttcattgatcttatgatttgtaacaatcgatggtttgcataacttcgaaacagagcatctgtctgcatcctaaactt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39852484 |
tctaatatgaggttaatcttcatttcattgatcttatgatttgtaacaatcaatggtttgcataacttcgaaacagagcatctatctgcatcctaaactt |
39852583 |
T |
 |
| Q |
118 |
tatttgtcacataaaaaataaaca-----cacttactgaaaaagaataatccccaattaacacatacagggataatatccactcaatttggtccctatta |
212 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||| || ||||||||| |
|
|
| T |
39852584 |
tatttgtcacataaaaaataaacactacccacttactgaaaaagaataatccccaatta--acatacagggataatatc--------atgatccctatta |
39852673 |
T |
 |
| Q |
213 |
ttccaagtgtttatataaagataattgggtgcttattcgtccgaaccactcaatttggtcacctagacctattgtgcatggcgtttgctagaactggtta |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
39852674 |
ttccaagtgtttatataaagataattgggtgcttattcgtccgaaccactaaatttggtcacctagacctattgtgcatggcgtttgctagcactggtta |
39852773 |
T |
 |
| Q |
313 |
tgtctccctat |
323 |
Q |
| |
|
||||||||||| |
|
|
| T |
39852774 |
tgtctccctat |
39852784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University