View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16598_low_12 (Length: 378)
Name: NF16598_low_12
Description: NF16598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16598_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 20 - 369
Target Start/End: Original strand, 5665198 - 5665546
Alignment:
| Q |
20 |
gcaagaagcatcatctcagttgtacattgagccaccacatttctctcagcagttcgctgaagcagcattgcagtctttcagaataggcagaagcctagag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
5665198 |
gcaagaagcatcatctcagttgtacattgagccaccacatttctctcagcagtttgctgaagcagcgttgcagtcttgcagaataggcagaagcctagag |
5665297 |
T |
|
| Q |
120 |
ggtcttttgagaggtttggtacaaaggagaggataaggggttatttttcgggagcagacggatatagctgcctaaagggagcaatagattgaggaggagg |
219 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5665298 |
ggtcttttgagaggtttggtacaaagaagagggtaaggggttatttt-cgggagcagacagatatagctgcctaaagggagcaatagattgaggaggagg |
5665396 |
T |
|
| Q |
220 |
actttgaccagggaaaggaggaggagttcgacaatatcatggtcgaccagcatgacacttccgggtttggcccaaattttatgtgattatgcacttttct |
319 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5665397 |
actttgaccatggaaaggaggaggagtttgacaatatcatggtcgaccagcatgacacttccgggtttggcccaaattttatgtgattatgcacttttct |
5665496 |
T |
|
| Q |
320 |
tatcactaatgtagttgtttttattttcatgtagttgttctaagaataat |
369 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5665497 |
tatcactaatgtagttgtttttattttcatgtagttgttctaaaaataat |
5665546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University