View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16598_low_4 (Length: 562)
Name: NF16598_low_4
Description: NF16598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16598_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 531; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 531; E-Value: 0
Query Start/End: Original strand, 10 - 544
Target Start/End: Original strand, 11193784 - 11194318
Alignment:
| Q |
10 |
ataattctcactgaatcccctcttcttctctattctgctacacctcttttctctcatacaccctccccttattgtcacaactgcttcagaaccttaccac |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11193784 |
ataatcctcactgaatcccctcttcttctctattctgctacacctcttttctctcatacaccctccccttattgtcacaactgcttcagaaccttaccac |
11193883 |
T |
|
| Q |
110 |
cttcacaaacatttcaatgtccttcttgctcaaactaccttttctgcagccaaaaatgcctctccattgccctcaattcctctcattcatcttggacatg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11193884 |
cttcacaaacatttcaatgtccttcttgctcaaactaccttttctgcagccaaaaatgcctctccattgccctcaattcctctcattcatcttggacatg |
11193983 |
T |
|
| Q |
210 |
tcaaacactctctcatcttcaaaaccctacttcaccattatcagaaaaaccttgtgaacttcaagttcaagctcgtttgattgttgctgcttacaatctt |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11193984 |
tcaaacactctctcatcttcaaaaccctacttcaccattatcagaaaaaccttgtgaacttcaagttcaagctcgtttgattgttgctgcttacaatctt |
11194083 |
T |
|
| Q |
310 |
gctattcacaccccttcaaaacttcaaactttactttcacttcatggtaatcctaatgatcaagattccatagttgataatgctaagtttcttcattctc |
409 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11194084 |
gctattcacaccccttcaaaacttcaaactttactttcacttcatggtaatcctaatgatcaagattccatagttgataatgctaagtttcttcattctc |
11194183 |
T |
|
| Q |
410 |
ttatctcacctttttgttcaccccacatgaatttttcagctgaactagctgctaaaatcattgccaaagaaagattgaactctttttgcttgatggagcc |
509 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11194184 |
ttatctcacctttttgttcaccccacatgaatttttcagctgaactagctgctaaaatcattgccaaagaaagattgaactctttttgcttgatggagcc |
11194283 |
T |
|
| Q |
510 |
ttattcccaaaagggtcctcaaagatccattaagg |
544 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
11194284 |
ttattcccaaaagggtcctcaaagatccattaagg |
11194318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University