View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16599_low_7 (Length: 239)
Name: NF16599_low_7
Description: NF16599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16599_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 74 - 222
Target Start/End: Complemental strand, 52475255 - 52475109
Alignment:
| Q |
74 |
attccaccaccatttagctcaactattgtgaattctttgttagggatataatttaacttatatgatggaaagtataaaaatttgttttaggtagttttaa |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52475255 |
attccaccaccatttagctcaactattgtgaattctt-gttagg-atataatttaacttatatgatggaaagtataaaaatttgttttaggtagttttaa |
52475158 |
T |
|
| Q |
174 |
tactatctttaaagatttcatagtccgcaacgggagcggtgcaaatatt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
52475157 |
tactatctttaaagatttcatagtccgcaacgggaacggtgcaaatatt |
52475109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 52475324 - 52475291
Alignment:
| Q |
1 |
ggaggtagtagaatagaacttgaataatggtcaa |
34 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
52475324 |
ggaggtaatagaatagaacttgaataatggtcaa |
52475291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University