View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16600_high_14 (Length: 407)
Name: NF16600_high_14
Description: NF16600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16600_high_14 |
 |  |
|
| [»] scaffold0598 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0598 (Bit Score: 258; Significance: 1e-143; HSPs: 2)
Name: scaffold0598
Description:
Target: scaffold0598; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 110 - 391
Target Start/End: Complemental strand, 7756 - 7475
Alignment:
| Q |
110 |
gaagtgtcacggttcaatgcggctggcaccggagttatatactgccacctttgagaacacccatatgactgttgaacaggacgagcaacagatctagaag |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7756 |
gaagtgtcacggttcaatgcggctggcaccggagttatatactgccacctttgagaacacccatatgactgttgaacaggacgagcaacagatctagaag |
7657 |
T |
 |
| Q |
210 |
aaagctttgacgtgttgttatgaataaaaagccttcgctcggaactgtcactagcacttgttctagcactgctacaggtgctgttggtgctgttgctccg |
309 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7656 |
aaagctttgacatgttgttatgaataaaaagccttcgctcggaactgtcactagcacttgttctagcgctgctacaggtgctgttggtgctgttgctccg |
7557 |
T |
 |
| Q |
310 |
cgacgaaagcaacgagcctttgctgccaatgctgctggttcggctcgtgatgtcaatattgttgagagggaatgaatgaggt |
391 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7556 |
cgacgaaagtaacgagcctttgctgccgatgctgctcgttcggctcgtgatgacaatattgttgagagggaatgaatgaggt |
7475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0598; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 4 - 50
Target Start/End: Complemental strand, 7862 - 7816
Alignment:
| Q |
4 |
aatgaaaaaccaccggaaaatactccggacaacgcgcaaagataccc |
50 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7862 |
aatgaaaaaccaccggaaaatactccggacaacgcgcaaagataccc |
7816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University