View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16600_high_19 (Length: 384)
Name: NF16600_high_19
Description: NF16600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16600_high_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 351; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 351; E-Value: 0
Query Start/End: Original strand, 10 - 368
Target Start/End: Complemental strand, 49824452 - 49824094
Alignment:
| Q |
10 |
agatgaaggacaatgagaatacaccaagcagtaagggagtgggaaggaataaggattgtgaagacataacacctagccgtaagggagtggaaaatactaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49824452 |
agatgaaggacaatgagaatacaccaagcagtaagggagtgggaaggaataaggattgtgaagacataacacctagccgtaagggagtggaaaatactaa |
49824353 |
T |
|
| Q |
110 |
ggacaatgacaagacaccaagcagtgaggtaattggcaagcggatggacaatgaaaaaacaccaaagagcaagggagttggcaagaggacaactgatagt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
49824352 |
ggacaatgacaagacaccaagcagtgaggtaattggcaagcggatggacaatgaaaaaacaccgaagagcaagggagttggcaagaggacaactgatagt |
49824253 |
T |
|
| Q |
210 |
gtgggctctgattttgacaaacctgaagtcggcgaagggtcaattaagaaacctatgccagtgtctaagcgcattaagacttcgaaagtttaaaaatccc |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49824252 |
gtgggctctgattttgacaaacctgaagtcggcgaagggtcaattaacaaacctatgccagtgtctaagcgcattaagacttcgaaagtttaaaaatccc |
49824153 |
T |
|
| Q |
310 |
atgtcagttgactatgcctttgtttgtctgccttgcatctaattgagtattgttgattc |
368 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49824152 |
atgtcagttgactatgcctttgtttgtctgccttgcatctaattgagtattgttgattc |
49824094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University