View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16600_high_32 (Length: 299)
Name: NF16600_high_32
Description: NF16600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16600_high_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 62 - 294
Target Start/End: Complemental strand, 36324015 - 36323781
Alignment:
| Q |
62 |
ggatggttcaatgtcgctctagtcacgacacattgcttcactttagatgtaaagtatgtaatctcaaccgttgac--gagaaaatcaatattgatatttc |
159 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36324015 |
ggatgtttcaatgtcgctctagtcacgacacattgcttcactttagatgtaaagtatgtaatctcaaccgttgacacgagaaaatcaatattgatatttc |
36323916 |
T |
 |
| Q |
160 |
agtttatacatcatctattgatcttctcatgtcatcaaccactgagcttgggattacttactttgtataatgtagccatgttgaaggaagtaattacctg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36323915 |
agtttatacatcatctattgatcttctcatgtcatcaaccactgagcttgggattacttactttgtataatgtagccatgttgaaggaagtaattacctg |
36323816 |
T |
 |
| Q |
260 |
taatagattgtaatttatgttggtttcatttcagt |
294 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||| |
|
|
| T |
36323815 |
taatagattgtaatttatgttggtttgatgtcagt |
36323781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University